Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG263

SGN-M189

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATCCTCCTTCATTCAGTTTAGATATTACCCAGATAATGTCATCCGACACTAATTGTGTTTATGAACATGAAGACATAGGTTCGACTGAGA
ATAGATCGAAAAAATTGCATGATCCCCTAGTTATGGTCGATGATGAGAAGGTGAAGAAGGATGCGCTTTCTTCTTCAAAAGCAAAGATTG
AAAAACCCCTAAAAAGGGGGTAGAAAAAAGTATAACCCCAATTTTCCGTTCGAATCTAATTGAGGCAACTAGTTCCTATCTGTTGTTGTT
TTTTTTTGTTGCTCAATCTTTGAATCAATTGTTAATCTTTAATCAAGTGTTAATTTGAATCTTTTTTCTATGTAGTTAAAAATTGTTAAA
ATTAACAATTTCATCTTGTATCCAATTATTTGTGTACAAATTTACTTCCCTTATTTCATTTTAAATTTTCATGCTCATTAAAAAGTGTAG
TTTAATAATTTATCT
Reverse sequence
TCAGCAAGATCAATTCACAGCAAGTTCAATTTCAATTTTCTATTAATTCAATCAATCGATATACATGTGAACTGGGAAATTACTTGAAAA
TTGGTGTTTAGAGATAATAGATGCAATACCACTTTTTCCTCATCCGAAAAGCAACAAGTGGCCTTATAGTTTGTCTACATTCAAGTATGC
TGCATCCACTATAATTCATTTATCAATTCTTGAGTCATATTCTATGTGAATTATCGGGAGACAGTTTGAACTTTATTGTTTAATATAAAA
TTTATTTAAGTTATCTACATTCAAGTATGTAAAGGAATCGTTAATTGCAATGAGATTGACAATTTAAAATATAGTTATAAAATAGTTATA
TGAAGTAAATATGAATAAAATATTGTGAGGAATTGTTACATTATGAAATACACAATTCCAAACAATTAATATATATAATTTATTATTATT
TTTTTGGAGTTATTTGTGTTACTACATAATAATTTATTTGACATTTTTGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1587069.6e-1873 (15.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53242)
Chromosome
12
Position
40.90 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53243)
Chromosome
12
Position
44.82 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53241)
Chromosome
12
Position
43.93 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39968)
Chromosome
12
Position
19.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8508)
Chromosome
12
Position
18.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8509)
Chromosome
12
Position
21.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8507)
Chromosome
12
Position
26.20 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8506)
Chromosome
12
Position
36.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG263 was used as an overgo probe on plate 4 [well A3]

Plausible BAC Matches:   P244J04

 Non-Plausible BAC matches

P010A10,   P189I08,   P054J03,   P021A02,   P198F11,   P256P24,   P238C06,   P271N16,   P003A09,   P203C20,   P070F16,   P158P24

 Overgo Sequences

A sequence
GCATGATCCCCTAGTTATGGTCGA
B sequence
CTTCACCTTCTCATCATCGACCAT
AB sequence
GCATGATCCCCTAGTTATGGTCGATGATGA
Marker sequence
ATCCTCCTTCATTCAGTTTAGATATTACCCAGATAATGTCATCCGACACT
AATTGTGTTTATGAACATGAAGACATAGGTTCGACTGAGAATAGATCGAA
AAAATTGCATGATCCCCTAGTTATGGTCGATGATGAGAAGGTGAAGAAGG
ATGCGCTTTCTTCTTCAAAAGCAAAGATTGAAAAACCCCTAAAAAGGGGG
TAGAAAAAAGTATAACCCCAATTTTCCGTTCGAATCTAATTGAGGCAACT
AGTTCCTATCTGTTGTTGTTTTTTTTTGTTGCTCAATCTTTGAATCAATT
GTTAATCTTTAATCAAGTGTTAATTTGAATCTTTTTTCTATGTAGTTAAA
AATTGTTAAAATTAACAATTTCATCTTGTATCCAATTATTTGTGTACAAA
TTTACTTCCCTTATTTCATTTTAAATTTTCATGCTCATTAAAAAGTGTAG
TTTAATAATTTATCT
Genomic location of TG263  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D189 marker 189
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)