SGN Marker solcap_snp_sl_12289

SGN-M18901

Synonyms  
3674_2_84
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70801)
Chromosome
5
Position
73.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55232)
Chromosome
5
Position
62.57 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGATATCTCAAGTATTCATTTTCTCTTAGCAGAGGTTTCGCTTCGGGATC
  
3' flanking region
GATGAGAACGACGTCGTTGTTATTGGTGGTGGACCTGGCGGATATGTGGC
SNP nucleotide
CG
SNPdb format
AGATATCTCAAGTATTCATTTTCTCTTAGCAGAGGTTTCGCTTCGGGATC[C/G]
GATGAGAACGACGTCGTTGTTATTGGTGGTGGACCTGGCGGATATGTGGC
  
Genomic location of solcap_snp_sl_12289  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18901 marker 18901
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)