SGN Marker solcap_snp_sl_123

SGN-M18903

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70803)
Chromosome
5
Position
65.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55234)
Chromosome
5
Position
61.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAACCAGAACAAATAGACTGATTGATTGTGGTCAGATCAGAGCCCTCTAT
  
3' flanking region
GTTCGTTGGAGGATGTTGAACTAATGTTGCTATTCTCACCTCAATCTTGG
SNP nucleotide
TC
SNPdb format
GAACCAGAACAAATAGACTGATTGATTGTGGTCAGATCAGAGCCCTCTAT[T/C]
GTTCGTTGGAGGATGTTGAACTAATGTTGCTATTCTCACCTCAATCTTGG
  
Genomic location of solcap_snp_sl_123  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18903 marker 18903
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)