SGN Marker solcap_snp_sl_12354

SGN-M18908

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63677)
Chromosome
1
Position
72.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55239)
Chromosome
1
Position
72.70 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAATTTCAACGTAACATCTTTTGCTCAACTTAGATAAACTATGATCATA
  
3' flanking region
CCTTCTCTCTAATCTGTTACTATTAACTTATATACACTGACAGTGCACGT
SNP nucleotide
AC
SNPdb format
CTAATTTCAACGTAACATCTTTTGCTCAACTTAGATAAACTATGATCATA[A/C]
CCTTCTCTCTAATCTGTTACTATTAACTTATATACACTGACAGTGCACGT
  
Genomic location of solcap_snp_sl_12354  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18908 marker 18908
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)