SGN Marker solcap_snp_sl_12359

SGN-M18912

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70807)
Chromosome
1
Position
58.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67225)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55243)
Chromosome
1
Position
72.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGGACCCCGCGGGACGACCTCTAGGTCTACGTGCTACCCCGGGGCTATT
  
3' flanking region
TTGTTATTGTTATCGTTGTTGTTGTTGTCATCATCGGAAAATTGAGTGTT
SNP nucleotide
AG
SNPdb format
TTGGACCCCGCGGGACGACCTCTAGGTCTACGTGCTACCCCGGGGCTATT[A/G]
TTGTTATTGTTATCGTTGTTGTTGTTGTCATCATCGGAAAATTGAGTGTT
  
Genomic location of solcap_snp_sl_12359  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18912 marker 18912
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)