SGN Marker solcap_snp_sl_12752

SGN-M18949

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70824)
Chromosome
6
Position
31.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67243)
Chromosome
6
Position
35.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55280)
Chromosome
6
Position
36.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTTGTGCACACCTCAACAATTCTACCGGATACTGCAACCTCCCACCATC
  
3' flanking region
CAGGTACTGGGCACTCTGTCCACCAAGGCTTAAGAAGATGGGAAAAAATA
SNP nucleotide
AG
SNPdb format
GCTTGTGCACACCTCAACAATTCTACCGGATACTGCAACCTCCCACCATC[A/G]
CAGGTACTGGGCACTCTGTCCACCAAGGCTTAAGAAGATGGGAAAAAATA
  
Genomic location of solcap_snp_sl_12752  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18949 marker 18949
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)