Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_12757

SGN-M18953

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63692)
Chromosome
6
Position
46.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55284)
Chromosome
6
Position
36.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGTAAAAATGCTTGCAAAGGGCAGAAGACCTCCCACCAGAGAAATAACA
  
3' flanking region
ATGGTCTTAGGTACCATTTCTTCTCAGGGATAGGACGCGGAATATTCTTA
SNP nucleotide
TG
SNPdb format
CAGTAAAAATGCTTGCAAAGGGCAGAAGACCTCCCACCAGAGAAATAACA[T/G]
ATGGTCTTAGGTACCATTTCTTCTCAGGGATAGGACGCGGAATATTCTTA
  
Genomic location of solcap_snp_sl_12757  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18953 marker 18953
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)