Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_12766

SGN-M18961

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67247)
Chromosome
6
Position
35.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55292)
Chromosome
6
Position
37.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCATACAACTTCTTGACCACCGTAGCACCGCCGCCAACTGCGGCGGTACC
  
3' flanking region
GCGGCGGAGATGATGGCGAAGACTGTTTGTTTGTGTTGGCAAATTGGATA
SNP nucleotide
TG
SNPdb format
TCATACAACTTCTTGACCACCGTAGCACCGCCGCCAACTGCGGCGGTACC[T/G]
GCGGCGGAGATGATGGCGAAGACTGTTTGTTTGTGTTGGCAAATTGGATA
  
Genomic location of solcap_snp_sl_12766  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18961 marker 18961
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)