SGN Marker solcap_snp_sl_12799

SGN-M18966

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55297)
Chromosome
3
Position
43.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGATTTTGAAGTTCACCCAACTCTTCAATTCTTGAATCACTAAATGCACC
  
3' flanking region
ACGACAAATCTTGTTGAATAAGAAAGTAGGAGAATCTGTAACTTGCTTTT
SNP nucleotide
TC
SNPdb format
AGATTTTGAAGTTCACCCAACTCTTCAATTCTTGAATCACTAAATGCACC[T/C]
ACGACAAATCTTGTTGAATAAGAAAGTAGGAGAATCTGTAACTTGCTTTT
  
Genomic location of solcap_snp_sl_12799  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18966 marker 18966
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)