SGN Marker TG337

SGN-M190

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1690
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG337 image not available
Forward sequence
TGTTCTCTGCTGTCTCTGGACTAGAACTTTCAATGGCAAAGCATCATCACCAATGTGAGTCCATATCTTTTGGCAGATCTGTTGTTCCCT
AATGGCCCCCTTGCCCATATCCCTTGGTGAAGAAAATGAAGAATCATAAGTCATATCTATTATATTTTACAGCTTTCTTCCATATTATTA
AAAGATGCTCATTCTTGTTATGTCAAAACAGTACTTATTAGATGATATTCTGATGCTCTAGCTAACTGATTAACTGAAAAGACCTAGGAG
TGTTTATGACAAAGTGTAGAATATAATAATTGAAAATAGTTTCTGGTCTAGTGTATGTCTGGTTTAAAGTAGTCATAATGAACTACTTTC
TTTGTTAAAATTTATTTGTTTGGTTTTGACTTGACATGAAGTTTAAAAAAGTGAAGTGTTCTTAAACTAAAGACAGGTAAATTATACTAA
AATATTTTTTAATTTTG
Reverse sequence
ATACAAATCATTTCAGCATAATATTCATTAGTTCCACAGTTATTGCTTCTTGTTTCAACAAAAAGATTTTCAGTATGATCTTAGACTATA
ACAATAATCAGTGACATCTTCATCATCCATAGAAACAAAATAAGTTTGCTTCTGACTCCCATAATTTCAAAAATTAACTCGAGAAATCAT
CAAAACTCCATACTAGTTAAGCAAGCATCATCAAATAACTGTCCTGTATCTGTAATTATATGATTGGTTTGAACCACATTTTCAGATTTT
TTCTTGATACAGAAATCCATAAGTTGCTAGTATGAGTCCATTTTAGAGAAGGAATATCCATATTATGGGCCACACGCAATATTTATATGA
ATAATAAGATTTCTTAGCTTATTCTCCAAACAATTGCAACAAAACTATCAGTTATCATTTTGCTGTCAAACAGACACACCCAACTATTTA
GGTAATTAGTTTCTACAGTTCCTTATCATAATCACTATCTACAATTTTAAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53886)
Chromosome
2
Position
68.60 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50372)
Chromosome
2
Position
44.14 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48306)
Chromosome
2
Position
104.44 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43601)
Chromosome
2
Position
72.00 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43320)
Chromosome
2
Position
82.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40860)
Chromosome
2
Position
79.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36579
Forward primer (5'-3')
GCAAAGCATCATCACCAATG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ATTATGGGCCACACGCAATA
Digested band sizes (using HindIII)
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40001)
Chromosome
2
Position
95.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8513)
Chromosome
2
Position
81.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8516)
Chromosome
2
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG337 was used as an overgo probe on plate 16 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTCTCTGGACTAGAACTTTCAATG
B sequence
GGTGATGATGCTTTGCCATTGAAA
AB sequence
GTCTCTGGACTAGAACTTTCAATGGCAAAG
Marker sequence
TGTTCTCTGCTGTCTCTGGACTAGAACTTTCAATGGCAAAGCATCATCAC
CAATGTGAGTCCATATCTTTTGGCAGATCTGTTGTTCCCTAATGGCCCCC
TTGCCCATATCCCTTGGTGAAGAAAATGAAGAATCATAAGTCATATCTAT
TATATTTTACAGCTTTCTTCCATATTATTAAAAGATGCTCATTCTTGTTA
TGTCAAAACAGTACTTATTAGATGATATTCTGATGCTCTAGCTAACTGAT
TAACTGAAAAGACCTAGGAGTGTTTATGACAAAGTGTAGAATATAATAAT
TGAAAATAGTTTCTGGTCTAGTGTATGTCTGGTTTAAAGTAGTCATAATG
AACTACTTTCTTTGTTAAAATTTATTTGTTTGGTTTTGACTTGACATGAA
GTTTAAAAAAGTGAAGTGTTCTTAAACTAAAGACAGGTAAATTATACTAA
AATATTTTTTAATTTTG
Genomic location of TG337  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D190 marker 190
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)