SGN Marker solcap_snp_sl_13398

SGN-M19018

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70848)
Chromosome
1
Position
121.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67263)
Chromosome
1
Position
109.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63708)
Chromosome
1
Position
191.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55349)
Chromosome
1
Position
88.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATAAAATGGTGAAATGGTGTCCAAGTATCCCTCATTGTGGGAATGCTAT
  
3' flanking region
CGAGTAGAGACCGATGAGTTCTGTGAAGTAGAATGTTCATGTGGTTTACA
SNP nucleotide
AT
SNPdb format
AATAAAATGGTGAAATGGTGTCCAAGTATCCCTCATTGTGGGAATGCTAT[A/T]
CGAGTAGAGACCGATGAGTTCTGTGAAGTAGAATGTTCATGTGGTTTACA
  
Genomic location of solcap_snp_sl_13398  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19018 marker 19018
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)