Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_13404

SGN-M19023

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70850)
Chromosome
1
Position
120.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67266)
Chromosome
1
Position
109.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63711)
Chromosome
1
Position
189.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55354)
Chromosome
1
Position
87.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGAGAATCAATGCCCAGACTGGATATACCAGAAGAAGGATGATTCCAAT
  
3' flanking region
GTGTTTGAAATTCCATGAGCTTTAGTGAAAGAATTTCTGAATCCACCAGA
SNP nucleotide
AC
SNPdb format
TGGAGAATCAATGCCCAGACTGGATATACCAGAAGAAGGATGATTCCAAT[A/C]
GTGTTTGAAATTCCATGAGCTTTAGTGAAAGAATTTCTGAATCCACCAGA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_13404  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19023 marker 19023
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)