Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_13453

SGN-M19036

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63717)
Chromosome
8
Position
37.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55367)
Chromosome
8
Position
51.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTCTTTTAGTTCTAGAGGCGTGTGTTCTTTTCCCAGAATAGAACTTAAG
  
3' flanking region
TGTTGCAAATCCTCCTGGATATTTTTGGTATGCGGCTGCACTGTAATAAT
SNP nucleotide
TC
SNPdb format
TGTCTTTTAGTTCTAGAGGCGTGTGTTCTTTTCCCAGAATAGAACTTAAG[T/C]
TGTTGCAAATCCTCCTGGATATTTTTGGTATGCGGCTGCACTGTAATAAT
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_13453  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19036 marker 19036
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)