SGN Marker solcap_snp_sl_13455

SGN-M19037

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63718)
Chromosome
8
Position
37.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55368)
Chromosome
8
Position
51.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTTGCCTCAGAACAGTCCGAGGAGCTTCAACGAGTCGTCTGATTCGTT
  
3' flanking region
GATGGATCTCCGGGTCGGGTCGGGTTTGAATCTTTTTCGTCTTCTCCACC
SNP nucleotide
TC
SNPdb format
GTTTTGCCTCAGAACAGTCCGAGGAGCTTCAACGAGTCGTCTGATTCGTT[T/C]
GATGGATCTCCGGGTCGGGTCGGGTTTGAATCTTTTTCGTCTTCTCCACC
  
Genomic location of solcap_snp_sl_13455  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19037 marker 19037
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)