SGN Marker solcap_snp_sl_13458

SGN-M19040

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70856)
Chromosome
8
Position
29.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63719)
Chromosome
8
Position
37.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55371)
Chromosome
8
Position
51.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAGCCTATTAATCTCTATTTTGTGTTTGCTTATTTGGGTATTAGGGGGAA
  
3' flanking region
TTTTTGAATATTTTGTACATAAAGAAGAAGAAGAAGATGATTTAGGGTTC
SNP nucleotide
CG
SNPdb format
TAGCCTATTAATCTCTATTTTGTGTTTGCTTATTTGGGTATTAGGGGGAA[C/G]
TTTTTGAATATTTTGTACATAAAGAAGAAGAAGAAGATGATTTAGGGTTC
  
Genomic location of solcap_snp_sl_13458  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19040 marker 19040
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)