SGN Marker solcap_snp_sl_13516

SGN-M19056

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70865)
Chromosome
2
Position
34.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67277)
Chromosome
2
Position
49.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63725)
Chromosome
2
Position
69.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55387)
Chromosome
2
Position
36.41 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGGAAAGTTTGGTCCATTTCATCTATTTCCTTAGTAGCACTGCTCCATG
  
3' flanking region
TAGCTTGAGCTTGGCCATTGTTCTCTTCCTTGCAGCAACTCCAATTTTGT
SNP nucleotide
TG
SNPdb format
TTGGAAAGTTTGGTCCATTTCATCTATTTCCTTAGTAGCACTGCTCCATG[T/G]
TAGCTTGAGCTTGGCCATTGTTCTCTTCCTTGCAGCAACTCCAATTTTGT
  
Genomic location of solcap_snp_sl_13516  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19056 marker 19056
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)