SGN Marker solcap_snp_sl_13582

SGN-M19099

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70892)
Chromosome
2
Position
35.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67299)
Chromosome
2
Position
52.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63746)
Chromosome
2
Position
71.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55430)
Chromosome
2
Position
36.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAATCTCTATTGAAACCAGAAGTATCGAGAATTGCCATTGTGTTCTCTTC
  
3' flanking region
ATTCCTCCATTGTTGCTTCCTCCTCCCTTTCGCTTTTCCATGTTGCTTCC
SNP nucleotide
AG
SNPdb format
GAATCTCTATTGAAACCAGAAGTATCGAGAATTGCCATTGTGTTCTCTTC[A/G]
ATTCCTCCATTGTTGCTTCCTCCTCCCTTTCGCTTTTCCATGTTGCTTCC
  
Genomic location of solcap_snp_sl_13582  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19099 marker 19099
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)