SGN Marker TG129

SGN-M191

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG129 image not available
Forward sequence
AATTCTGATCGTGGCAGTCTCCTAGCATGTAGGAGCCACATGTACCATTAGGATTTCCAAAGCTGGCAAATTTGACAGAGGAAATATTAG
TATTTGTGGGGCATTTCAAACTTAGAGTTGGCCTGTTTTTGTCGTTCTCAATTTCACTTCCTTGCAGATTTTCAACATCAAAGGATGGAT
GGTCCACTGAAAGATGACCACAAGCTCCAGAAACCTTTCGCATTGAGAATCTAATTTGAGAGGGATCTCCACCTATTTCCTCAAAGATAA
TTAAGACATTTCCTGATGGCTTGAACCAAGATCGTGGCACATGATACCTAATTAACAAGCAAAATAAGAGAAATTCTACTTTAAAATATG
GATGTATATAAAAAAGAGAAAACAACAAAAACTAGCATTAAGGTTGCAAACTGATGATACTACTTCGAACACTACTGGTCTTTAATCCAT
AACTGGAAACAAAGAAATGACCCATTAAAAAGTATATAGGAGTTT
Reverse sequence
GGGCTGAGTTAATGTTTTGGGATGTTAAAAGAGACTAATACTCTTCAAATATTGCATAGCTCTTATTTATTCCAAGGCTAGCCTTATTCC
AAATGCTTTTCCTTAGACTAACAGTACTTCGTTTTCTCTTTGAAGACAGCTGGAGCGTTTTATGAATGGATTGGAGCTGGTCCAACAAGT
GTCAAAGTTGCAGGGTTCAAGACTGGGACTATGGACTTGACTGCGTCTGCTTGGACCTATAAGGTATTGCATTTTCCTTCAGTTAAGTTT
GCACTCCAGCTTGCATCATTGTCAATCTAGGAAGCATGTATTCCTCTTTTTAAAGGTGTGTCACAGAATTGAAACTATTGGACATCCTCT
TCCAATATTTGGGAAAATCCCTTTATTAATCATGGTAAGGTAATGACATTGTTAAAGTGGGCACTTGTGCTATTACCTCTTTTTTCTTTT
AAGAGGAGAAGAGATTTAGGCTGAAGATCATGGAATGTATATGGAAGAAAGGACTCATTACTTCTATTTAGCTGTAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1580911e-131236 (47.7% of RFLP seq)+
SGN-U1580912.8e-55108 (20.5% of RFLP seq)-
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132215)
Chromosome
3
Position
73.96 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53170)
Chromosome
3
Position
60.27 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43830)
Chromosome
3
Position
75.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43581)
Chromosome
3
Position
59.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43290)
Chromosome
3
Position
62.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42403)
Chromosome
3
Position
84.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40832)
Chromosome
3
Position
80.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Eggplant-LXM 2002   
Map version
29 (location: 8518)
Chromosome
3
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8517)
Chromosome
3
Position
61.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8520)
Chromosome
3
Position
26.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8519)
Chromosome
3
Position
77.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG129 was used as an overgo probe on plate 4 [well B2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTCTGATCGTGGCAGTCTCCTAG
B sequence
ATGTGGCTCCTACATGCTAGGAGA
AB sequence
ATTCTGATCGTGGCAGTCTCCTAGCATGTA
Marker sequence
AATTCTGATCGTGGCAGTCTCCTAGCATGTAGGAGCCACATGTACCATTA
GGATTTCCAAAGCTGGCAAATTTGACAGAGGAAATATTAGTATTTGTGGG
GCATTTCAAACTTAGAGTTGGCCTGTTTTTGTCGTTCTCAATTTCACTTC
CTTGCAGATTTTCAACATCAAAGGATGGATGGTCCACTGAAAGATGACCA
CAAGCTCCAGAAACCTTTCGCATTGAGAATCTAATTTGAGAGGGATCTCC
ACCTATTTCCTCAAAGATAATTAAGACATTTCCTGATGGCTTGAACCAAG
ATCGTGGCACATGATACCTAATTAACAAGCAAAATAAGAGAAATTCTACT
TTAAAATATGGATGTATATAAAAAAGAGAAAACAACAAAAACTAGCATTA
AGGTTGCAAACTGATGATACTACTTCGAACACTACTGGTCTTTAATCCAT
AACTGGAAACAAAGAAATGACCCATTAAAAAGTATATAGGAGTTT
Genomic location of TG129  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D191 marker 191
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)