SGN Marker solcap_snp_sl_13586

SGN-M19101

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70894)
Chromosome
2
Position
35.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55432)
Chromosome
2
Position
36.90 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAATAGAAATATTTTCTACGTGTCCACACATTATTCGCTTAGAGTGCCA
  
3' flanking region
GAAATTCTCCATGCACAGCTCTGTTTTAACATCTTGATTCAAATACATCA
SNP nucleotide
AT
SNPdb format
TAAATAGAAATATTTTCTACGTGTCCACACATTATTCGCTTAGAGTGCCA[A/T]
GAAATTCTCCATGCACAGCTCTGTTTTAACATCTTGATTCAAATACATCA
  
Genomic location of solcap_snp_sl_13586  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19101 marker 19101
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)