SGN Marker solcap_snp_sl_13606

SGN-M19117

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67307)
Chromosome
2
Position
52.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63753)
Chromosome
2
Position
73.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55448)
Chromosome
2
Position
36.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCACATTCAAAATCTCAAGAACTATCTCAAATTTTCTATCTCTTTTCACC
  
3' flanking region
AATCTCATAAACCCTAATTCCCAAATGGCTCGTACTAAGCAAACAGCCCG
SNP nucleotide
AG
SNPdb format
TCACATTCAAAATCTCAAGAACTATCTCAAATTTTCTATCTCTTTTCACC[A/G]
AATCTCATAAACCCTAATTCCCAAATGGCTCGTACTAAGCAAACAGCCCG
  
Genomic location of solcap_snp_sl_13606  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19117 marker 19117
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)