SGN Marker T1305

SGN-M1912
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAH24TH
Arabidopsis best BAC match: AC004747.2
Arabidopsis position: 2.1470000
Arabidopsis identities: 0.814
Best GenBank protein hit: AAC31239.1
Evalue: 1.8e-59
Identities: 0.643
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53506)
Chromosome
12
Position
69.69 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39571)
Chromosome
12
Position
90.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35601
Forward primer (5'-3')
CCTTGTACCCCCAAATCTGA
Digested band sizes (using EcoRI)
Solanum lycopersicum LA925: 200+1050
Solanum pennellii LA716: 1250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCTGAATTTTGGCTCCAGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1250
Solanum lycopersicum LA925: 1250
Approximate temperature
50°C
  
PCR data   Exp. ID 154
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRI)
Solanum lycopersicum LA925: 200+1050
Solanum pennellii LA716: 1250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1250
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
T1305 was used as an overgo probe on plate 4 [well H11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCCGGTAACAACAAGAGGAAGTAC
B sequence
GTGCCGTTTGATCATCGTACTTCC
AB sequence
GCCGGTAACAACAAGAGGAAGTACGATGAT
Marker sequence
GCGAAAACCCTACCGCCGCTGCTCTCCTTGTACCCCCAAATCTGAGCAAA
TCGAAAGCAACAATGGCAGAAGAAGCACAGTACGGAGCACCAGATGCCGG
TAACAACAAGAGGAAGTACGATGATCAAACGGCACCGTCTCCTGGTCCAC
GTAGACCTACTGGATTTTCTGCTCCGATCGCTTCCTTATCTTCTCCCGAC
GGTGCTGCTCCTCCTTCGTCTTACAACAATGTTCCGCCGCCTATGGATGA
TTTCCAGTTGGCTAAGCAGAAGGCTCAGGAGATCGCTGCTAGGTTGTTGA
ATAGTGCTGAAGCGAAGAAACCTAGAGTTGATAATAACGGCGGTGGTGCC
GGTGGATATGATTCCTATGAACACAAGCCCATTGTTACTCCTTCAGTTAC
AAGTTCATATGGTTATCCGGGGCAGAGCAAGAAGATTGAAATACCAAATG
GCAGAGTTGGTGTGATTATAGGAAAAGGTGGGGAGACCATCAAGTATCTT
CAACTCCAGTCTGGAGCCAAAATTCAGGTTACTAGAGACATGGATGCTGA
TCCTAATTCTCAAAACAGAGCAGTTGAACTCATGGGTACTCCAGACCAAA
TTGCTAAGGCTGAACAGTTGATTAATGA
Genomic location of T1305  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1912 marker 1912
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)