SGN Marker solcap_snp_sl_13612

SGN-M19120

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70907)
Chromosome
2
Position
36.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55451)
Chromosome
2
Position
37.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTATTCAGGTTCCAAACCATGGAAACAGGTGGCCTGCTCCAAATCAGGA
  
3' flanking region
AATAACACTCCTTGCAAGCCAATTAATCCTGTCTCAGCATCATCACCGCC
SNP nucleotide
TC
SNPdb format
GGTATTCAGGTTCCAAACCATGGAAACAGGTGGCCTGCTCCAAATCAGGA[T/C]
AATAACACTCCTTGCAAGCCAATTAATCCTGTCTCAGCATCATCACCGCC
  
Genomic location of solcap_snp_sl_13612  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19120 marker 19120
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)