SGN Marker T1306

SGN-M1913
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAH34TH
Arabidopsis best BAC match: AL035538.1
Arabidopsis position: 4.1910000
Arabidopsis identities: 0.693
Best GenBank protein hit: CAB80487.1
Evalue: 2.8e-77
Identities: 0.695
Description: putative protein [Arabidopsis thaliana]
Comment: 1.00E-48 match with dbj|BAA76403.1| (AB017196) aminoacylase-I [Sus scrofa]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49419)
Chromosome
1
Position
90.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47353)
Chromosome
1
Position
153.66 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39572)
Chromosome
1
Position
165.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1306 was used as an overgo probe on plate 3 [well F6]

Plausible BAC Matches:   P009A08,   P116I06,   P088L02

 Overgo Sequences

A sequence
CCATCCTCCTTAACTCACATACCG
B sequence
TCGGAAGGGACAACATCGGTATGT
AB sequence
CCATCCTCCTTAACTCACATACCGATGTTG
Marker sequence
GGTGATGAGCAAGACCGGCTATTATCATGATTTGTGTGTGTTTCTGGTCA
CACTCATACTCATAATCACAACTAGGACGGCCGCTAAAGATCCGTCAACA
ATCCTATCAAGATTCCAGCAGTACCTTCAGATCAATACAGCCCAACCTCA
CCCCAACTACTATGAAGCTGCCGAATTTATAATATCACAGGCCAAGTTAC
TATCCCTCGAGTCCCAGACCCTTGAGTTCGTCAAGGGCAAACCTCTAATT
CTCCTCAAATGGCCAGGCAAAGACCCTACCCTCCCTTCCATCCTCCTTAA
CTCACATACCGATGTTGTCCCTTCCGAGCATCACAAGTGGACTCACCCAC
CTTTCTCTGCCCACTTAGATTCCACTACCGGCAACATCTTCGCCCGAGGT
TCTCAGGATATGAAATGCGTCGGCTTGCAGTACCTCGAGGCCATTCGCAA
ACTCAAATCTTATGGCTTCCGCCCCCTGCGCACTCTCTACCTCTCCTTCC
TCCCCGACGAGGAGATCGGTGGAAATGATGGTGCCAGAAAGTTTGTTGAT
TCAGATGTCTTGGCCAAGATGAATGTTGGGATTGTTCTTGACGAGGGCTT
GGCCTCTCCCACTCACAATTATCGCGCATTCTATGGAGAGAGGTCCCCCT
GGTGGCTTG
Genomic location of T1306  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1913 marker 1913
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)