SGN Marker solcap_snp_sl_13625

SGN-M19130

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70915)
Chromosome
2
Position
36.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67314)
Chromosome
2
Position
53.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63760)
Chromosome
2
Position
73.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55461)
Chromosome
2
Position
37.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCAAAGAGCAAGCTGAATCTGCTCAAGAGGAGGCAGAGGAGTGGAAACG
  
3' flanking region
AAGTACGGCATTGCTGCCAAGGAAGCAAAGAATGCTCTTGAGAAGGCAGC
SNP nucleotide
TC
SNPdb format
GCCAAAGAGCAAGCTGAATCTGCTCAAGAGGAGGCAGAGGAGTGGAAACG[T/C]
AAGTACGGCATTGCTGCCAAGGAAGCAAAGAATGCTCTTGAGAAGGCAGC
  
Genomic location of solcap_snp_sl_13625  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19130 marker 19130
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)