SGN Marker solcap_snp_sl_13899

SGN-M19161

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70933)
Chromosome
8
Position
24.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63774)
Chromosome
8
Position
21.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55492)
Chromosome
8
Position
3.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGTATATTTAAGAAAGAAATATTATGTAGTGATCTTTGATGCAAATGT
  
3' flanking region
TCAAAGATGGACTTGTATTAAATATGAGAAGCAATGGAAGCTCTGGAATA
SNP nucleotide
AG
SNPdb format
AATGTATATTTAAGAAAGAAATATTATGTAGTGATCTTTGATGCAAATGT[A/G]
TCAAAGATGGACTTGTATTAAATATGAGAAGCAATGGAAGCTCTGGAATA
  
Genomic location of solcap_snp_sl_13899  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19161 marker 19161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)