SGN Marker solcap_snp_sl_14034

SGN-M19171

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55502)
Chromosome
7
Position
57.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAATGTTGAGTCATAAGTGCAGGATTATGGATCCGGAAAAAGCAACAGG
  
3' flanking region
TTTTATATTCCGTTTTACGCCGGACTTGATATTGGGAAGTTTTTATGGTT
SNP nucleotide
CG
SNPdb format
AGAATGTTGAGTCATAAGTGCAGGATTATGGATCCGGAAAAAGCAACAGG[C/G]
TTTTATATTCCGTTTTACGCCGGACTTGATATTGGGAAGTTTTTATGGTT
  
Genomic location of solcap_snp_sl_14034  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19171 marker 19171
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)