Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_14085

SGN-M19183

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70948)
Chromosome
11
Position
56.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55514)
Chromosome
11
Position
48.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATTTCTTGGAAAGAGCAAAATGAGAGAACAAATACAAGTAAACTCTACT
  
3' flanking region
CTTGTGTAAAGGTACTTCCATTGGCTTCTTCACCTTCAACCTACAACTCA
SNP nucleotide
AG
SNPdb format
CATTTCTTGGAAAGAGCAAAATGAGAGAACAAATACAAGTAAACTCTACT[A/G]
CTTGTGTAAAGGTACTTCCATTGGCTTCTTCACCTTCAACCTACAACTCA
  
Genomic location of solcap_snp_sl_14085  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19183 marker 19183
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)