SGN Marker T1317

SGN-M1921
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TPTAN07TH
Arabidopsis best BAC match: AC003981.2
Arabidopsis position: 1.0220000
Arabidopsis identities: 0.941
Best GenBank protein hit: AAC50031.1
Evalue: 7.4e-88
Identities: 0.818
Description: violaxanthin de-epoxidase precursor [Nicotiana tabacum]
Comment: role in photosynthesis/photoprotection: xantophyll cycle
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39575)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14102
Forward primer (5'-3')
GCTCAACGTTCAATCTTCATAGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CTGTTTTCAAACAAATCACCACA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2100
Solanum pimpinellifolium LA1589: 2100
Approximate temperature
60°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
T1317 was used as an overgo probe on plate 7 [well B9]

Plausible BAC Matches:   P204I04,   P107M13,   P318C21,   P164C08,   P267I17,   P251A08,   P212M22,   P216N01,   P005K05,   P024J23,   P018L04,   P158F04,   P291H22,   P038E17,   P100B12,   P120F13,   P051N16,   P068D20

 Overgo Sequences

A sequence
AGGATAGAGCTTGCGAAGTGCATC
B sequence
CACATGCAGGGTTTGAGATGCACT
AB sequence
AGGATAGAGCTTGCGAAGTGCATCTCAAAC
Marker sequence
GCTCAACGTTCAATCTTCATAGCACTCTATTTACATGAGGTTGGAGTTGG
TGGTCATTCAATTGAATAATGGCGCTTGCCCCTCATTCAAACATTCTGTG
CAATCATGAAGCCATCAAATGTCAAGTTGGATCAAGGCTGCAGAGTCAGA
CAAGATTTAGCTGGGGTAGAGCAGATTACTTTGGTAGTATAGTCCTAGTG
AAAATTTGTTCCAGAAGACAGATACCTACATACTTGCAGAAATCTTCTAG
AATATGTTGTGGTTTGGATTCTAGAAGTCTGCAACTATCATCACGGGGGA
AACAAAATCTTTCTTCTGCACATAGAATTAACCAGAATGTACCTAAGGGA
AATACAATATGGAAATTTCCAGAAGATGTAGCTTTGATGGTCTTGAAGAA
ATGGGGCCAATTGGCCAAAACAGCAATTGTAACTATATTTATTTTGTCAG
TTGCTTCAAAGGCTGATGCCGTTGATGCTCTCAAAACTTGTACTTGCTTA
CTGAAAGAGTGCAGGATAGAGCTTGCGAAGTGCATCTCAAACCCTGCATG
TGCAGCTAATGTTGCCTGTCTCCAAACATGCAACAATAGACCTGATGAAA
CGGAATGTCAGATAAAATGTGGTGATTTGTTTGAAAACAGTGTTGTA
Genomic location of T1317  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1921 marker 1921
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)