Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_144

SGN-M19215

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55546)
Chromosome
5
Position
62.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATATCAATTCTAAATGACAAAGTACCTTTTCCTTATTATAATATCATC
  
3' flanking region
CATTCATAAACAGAGTACATTCACAAATCAAATAGAAAGCAGTTAAACAC
SNP nucleotide
AG
SNPdb format
ATATATCAATTCTAAATGACAAAGTACCTTTTCCTTATTATAATATCATC[A/G]
CATTCATAAACAGAGTACATTCACAAATCAAATAGAAAGCAGTTAAACAC
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_144  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19215 marker 19215
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)