SGN Marker solcap_snp_sl_14447

SGN-M19225

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55556)
Chromosome
6
Position
34.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAACTCCAACTGATTTCAACTCACTGATCACACTTTCTCAATTGTAAA
  
3' flanking region
ACCCAATTGAGTTATTTTCTTCTCCTTATATATTGAAACAAACAACGTGA
SNP nucleotide
TC
SNPdb format
TCAAACTCCAACTGATTTCAACTCACTGATCACACTTTCTCAATTGTAAA[T/C]
ACCCAATTGAGTTATTTTCTTCTCCTTATATATTGAAACAAACAACGTGA
  
Genomic location of solcap_snp_sl_14447  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19225 marker 19225
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)