SGN Marker solcap_snp_sl_14530

SGN-M19230

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70981)
Chromosome
8
Position
18.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67360)
Chromosome
8
Position
3.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55561)
Chromosome
8
Position
2.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCAATGTTGTAATTCCAACTTGACCTAATCCTTTAGTAAACAAACCAT
  
3' flanking region
TCTTTGTAACAATCTCATCGAGCTCTTCGCGATGAAATCTTCAACAAAGA
SNP nucleotide
AG
SNPdb format
CTTCAATGTTGTAATTCCAACTTGACCTAATCCTTTAGTAAACAAACCAT[A/G]
TCTTTGTAACAATCTCATCGAGCTCTTCGCGATGAAATCTTCAACAAAGA
  
Genomic location of solcap_snp_sl_14530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19230 marker 19230
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)