SGN Marker solcap_snp_sl_14531

SGN-M19231

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70982)
Chromosome
8
Position
18.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55562)
Chromosome
8
Position
2.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGGTTGTTTCCGATAAATCCTCGGAGGGAAACATTTATCAATACTCATC
  
3' flanking region
AACAACATTTTATCTAGTGTACATCTCATTTGCTATATGACTACTTGACA
SNP nucleotide
TC
SNPdb format
GAGGTTGTTTCCGATAAATCCTCGGAGGGAAACATTTATCAATACTCATC[T/C]
AACAACATTTTATCTAGTGTACATCTCATTTGCTATATGACTACTTGACA
  
Genomic location of solcap_snp_sl_14531  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19231 marker 19231
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)