SGN Marker solcap_snp_sl_14672

SGN-M19235

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67362)
Chromosome
9
Position
6.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55566)
Chromosome
9
Position
0.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTGGAACAGCTGAGCAGGTTCTAAATGCCGGTGTACTCGGTTATCGTCC
  
3' flanking region
CCTGAATTCGCGAGTACAAGTAAACCTTGTCCGTCTTTGAAAAGTGACGT
SNP nucleotide
AT
SNPdb format
GCTGGAACAGCTGAGCAGGTTCTAAATGCCGGTGTACTCGGTTATCGTCC[A/T]
CCTGAATTCGCGAGTACAAGTAAACCTTGTCCGTCTTTGAAAAGTGACGT
  
Genomic location of solcap_snp_sl_14672  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19235 marker 19235
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)