SGN Marker T1322

SGN-M1926
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAN14TH
Arabidopsis best BAC match: AB023046.1
Arabidopsis position: 3.0360000
Arabidopsis identities: 0.750
Best GenBank protein hit: BAB01267.1
Evalue: 6.0e-51
Identities: 0.497
Description: strong similarity to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39578)
Chromosome
4
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1322 was used as an overgo probe on plate 8 [well B3]

Plausible BAC Matches:   P006E18,   P336L13,   P171J15,   P190G18,   P218E22,   P165L02,   P297J08,   P122D08,   P273D07,   P145L14,   P164F08,   P119C19,   P176B07,   P256N02,   P277H16

 Overgo Sequences

A sequence
TGCTTGTAACCCTGCTGTCCAGAT
B sequence
GTCTATCAAGTCAGGCATCTGGAC
AB sequence
TGCTTGTAACCCTGCTGTCCAGATGCCTGA
Marker sequence
GTGACGTTGTTGGTGCTACAATTAAACAAGGACTTAATACTCTTACACAA
TCTCCTCCTCTCAAAAAGAATGATACTGGAACTTATACAAGTCCAAATCT
TCAGAGCTCATTGACAACTCAACCTGACACTTCTCACAATCATACTTCTC
GCTTTTCAACAAATCCTGCTTCTGCAACTTGGACTCACACTGAAACAACA
ACCAAGCCACATTCTGCTGAAAAGACCCGAGAAGACAGGTTATTAGAAAC
TATTGCAACCTCCGGTGGAGTTCGTCTGCAGCCAACTCGGGATGCACTTC
AGGTCTTCCTTCTCGAGGCTTCAAAATTAGATGCCTTGGCTTTGACCCAT
GCCCTTGAGTCAAAGCTGCAATCACCTTCGTGGCAGGTTCGTGTGAAAGC
AATCTGTGTCCTCGAGGCCATCTTGAGGAAAAAAGATGATGCTCACTTTG
GTACTATGGCATCTTATTTCACTGAAAATAGAGATGTTGTGGTAAAATGC
TATGAATCTCCCCAAGCATCATTAAGAGAAAAAGCAAACAAAGTCTTAAG
TCTTCTGAATGATGGACAAACAGCTGATGCTGTGGCTCATGTAGATAGGT
CAGCAAATGCTTGTAACCCTGCTGTCCAGATGCCTGACTTGATAGACACA
GAACAATTCTGATTATCTG
Genomic location of T1322  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1926 marker 1926
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)