SGN Marker T1323

SGN-M1927
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAN15TH
Arabidopsis best BAC match: AC003981.2
Arabidopsis position: 1.0220000
Arabidopsis identities: 0.875
Best GenBank protein hit: AAF99778.1
Evalue: 5.3e-56
Identities: 0.624
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49421)
Chromosome
2
Position
49.60 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47355)
Chromosome
2
Position
156.99 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39579)
Chromosome
2
Position
142.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1323 was used as an overgo probe on plate 10 [well H7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCATGAAACCAGCTCTTGTTCGTC
B sequence
GCAGCAACAGAGAGAAGACGAACA
AB sequence
GCATGAAACCAGCTCTTGTTCGTCTTCTCT
Marker sequence
GCAAGGTTCAGCATGAAACCAGCTCTTGTTCGTCTTCTCTCTGTTGCTGC
TCTCTTCTCCATTATACTTATCGCCATTCAGTCCTCTTTCTTCACTGGTA
GCCGGGCTCCCGTTAATTTGGATATTCCGATCTTGTCCCACTTCCAGTCT
AACCTTCAGCAATGCGTCGCTAACCGAGGGCTGGGATTGACTGCTCATAT
AATTGATCATTGCAGTGTCATTCTCAAGTTTCCCCAAGGAACTAATAGCA
CTTGGTATAATGAGCAGTTCAAGATCTTTGAACCATTGGAGTACAAGTAC
GACGTTTGCGAAGCAATACTTCTGTGGGAGCAGTACCGTAACATGACGAC
AGTGTTGACAAGAGAATATTTGGATTCTCGGCCTGATGGATGGTTTGACT
ATGCAGCAAAAAGGATTGCACAGCTAGGAGCAGACAAATGTTACAATCAG
ACTCTTTGCGAAGAACATCTCAATCTAACTTTACCAGCTAAGCCCCCGTT
TCACCCTCGACAATTCAGAAGATGTGCAGTCGTTGGCAATTCTGGA
Genomic location of T1323  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1927 marker 1927
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)