SGN Marker solcap_snp_sl_1490

SGN-M19302

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67383)
Chromosome
12
Position
37.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63822)
Chromosome
12
Position
38.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55633)
Chromosome
12
Position
3.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGGCAAGGGTGGTTGTCGACCCATATTTCGTATTTATGGACAGGATCCA
  
3' flanking region
TCATAGTTTCTGATCGGTCTCCGAAAAGCTTGTTCTCAACACAAAAGAAA
SNP nucleotide
TC
SNPdb format
ATGGCAAGGGTGGTTGTCGACCCATATTTCGTATTTATGGACAGGATCCA[T/C]
TCATAGTTTCTGATCGGTCTCCGAAAAGCTTGTTCTCAACACAAAAGAAA
  
Genomic location of solcap_snp_sl_1490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19302 marker 19302
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)