SGN Marker T1341

SGN-M1938
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAO08TH
Arabidopsis best BAC match: AB028605.1
Arabidopsis position: 5.1630000
Arabidopsis identities: 0.661
Best GenBank protein hit: BAA97529.1
Evalue: 9.3e-49
Identities: 0.549
Description: contains similarity to salt-inducible protein~gene_id:F10E10.5 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49425)
Chromosome
8
Position
58.21 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47359)
Chromosome
8
Position
66.12 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39585)
Chromosome
8
Position
51.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1341 was used as an overgo probe on plate 1 [well F3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCCAAAGTCTACTTGGGTAAACCC
B sequence
AGGTTTAGGCCTTGTGGGGTTTAC
AB sequence
GCCAAAGTCTACTTGGGTAAACCCCACAAG
Marker sequence
TCCAGATAAGGTGTCAAAATATCCACAAAATTCCTTATAGATGTATTTTC
ATTGAAGTTTCAAATCCAAATCCAAACTCTTTGGCCATGGCTGCAAAATT
CTCTACTGGTTTAGACATCCATTGCAGCATACCTTATACTTCAGATACAA
AGCTTCTTTATGGTTCATCTTCTTCCACCAAATCATCAAGATTGTCCATT
AAAAGATTCACAGTTCTTTGCAATTCCACTTCAAAATCACCAAAACCAAA
TCTTGATTTAGATTCTTCAAGAAAAAAACCCTCTCTTTCTGAACAACTAA
AGCCACTTTCCAACACCATTCTTGATGACCCACCAAACCAAGCAAGGATT
CTTTCTAAGCCAAAGTCTACTTGGGTAAACCCCACAAGGCCTAAACCTTC
TGTTTTGTCTTTACAGAGGCAGAAAAGGTCTTCTTACTCTTACAATCCTC
AAATTAGAGACCTTAAGAATTTTGCTAGGAGGTTAAGTGAGTCTCATTTC
TCTGATGATGCTTTCTTGGCTGTTCTTGAAGATATCCCACATCCACCCAC
TAGAGATAATGCTTTGTTGGTGCTTAATAGTTTGAGGCCATGGCAAAAGA
CCCTTTTTTTCTTTAATTGGATCAAGACTAGAAATTTGTTTGCTCTTGAA
ACTATCTTTTATAA
Genomic location of T1341  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1938 marker 1938
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)