SGN Marker solcap_snp_sl_1532

SGN-M19382

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55713)
Chromosome
12
Position
3.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTTCTGCTGACTTCAAAACAGAGCTCAGTCAATCTGATATGTTTGATCC
  
3' flanking region
CGTCTTCAGGCTAAGATTCTAAATGTGGTTGATGTTTCTTATGGAGGAGA
SNP nucleotide
TG
SNPdb format
GGTTCTGCTGACTTCAAAACAGAGCTCAGTCAATCTGATATGTTTGATCC[T/G]
CGTCTTCAGGCTAAGATTCTAAATGTGGTTGATGTTTCTTATGGAGGAGA
  
Genomic location of solcap_snp_sl_1532  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19382 marker 19382
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)