SGN Marker solcap_snp_sl_15418

SGN-M19390

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67414)
Chromosome
8
Position
50.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55721)
Chromosome
8
Position
59.01 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCAAAAATTTCGTTGAATATTAGGTTACCTGCAAAAAGGCAAAAGGCAA
  
3' flanking region
CCATCTGAATCCCTTCGCGGAACTTTCTATATTTGGTATGTGATATGCAG
SNP nucleotide
TC
SNPdb format
TCCAAAAATTTCGTTGAATATTAGGTTACCTGCAAAAAGGCAAAAGGCAA[T/C]
CCATCTGAATCCCTTCGCGGAACTTTCTATATTTGGTATGTGATATGCAG
  
Genomic location of solcap_snp_sl_15418  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19390 marker 19390
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)