SGN Marker TG31

SGN-M194

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AGTCGACCTGCAGATTAGTTGCTTTTAATATGCATCTTCTCCTATGTTTTGTTTCATCATGAATTATATTTGGAGAATTAAGTCTAATTA
TGTAGAAATGATGAATTGGGATGACGGTGCAGGATTGTTACCCCGATGGCTTTCCATTGGCCATAGAGTTGTATATCATTCTTGTCTGGT
ATTGGCGAAAACGTAGTTACATTCTTTCTTTCGGGATTAATGAAGTTGGTGGTTACTTTTGGTAAATAAACCAATTTCATAACCAATTAA
ACTAAAATTTTCATTGCTAATAAGTTGGTGCCCTACCTTTTATGGGTGTCGTTGAAATCCTTAGCCTCTATATTTATTAGATAACTCTTT
ATTTTGTTGATAAAACCGATAAGATTTTATGGATATG
Reverse sequence
ATCCCACCAACCTAAAATTTCAAGAAATTTATTGTGTAAATATGAAGTGTTAGCAACAAAAGCAAACATTTTTCACCATACAAACAGTAT
ATGATTGTAGATCTGTAATTTCCTTGCTGTAGATTATAATTTTCATACAACTAATTTTAAGACTAAAATTAGAAGGAACAAAGCACTTGT
AATATCTGATTTCTACATAACCTATGTGAAGTTATGTTGTGGATACCTGACATGGTTGTGACTGCTGGCACATGGACGATATGCATTTAC
CAGCATGTATGAGTTTTTTTTTGGGTTAATTAAAGTAAAGCTTTCTCATACTCCGTATAACATATATATATAAATATGACATGAACCCAA
AATCAAGCCAAATACCCAATCAATCATTGGTCAAACATCTAAATCCACTGTGGATTCCAACCACACTCAATTGTGTGGGATCTCCACAAG
TGCATCAAGGATTTTGAAGGGTCTTAGCAACATACACATGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53264)
Chromosome
2
Position
50.43 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50368)
Chromosome
2
Position
21.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48302)
Chromosome
2
Position
5.71 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42438)
Chromosome
2
Position
1.90 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39991)
Chromosome
2
Position
4.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8536)
Chromosome
2
Position
20.51 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8531)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8533)
Chromosome
2
Position
2.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8532)
Chromosome
2
Position
1.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8538)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG31 was used as an overgo probe on plate 16 [well G1]

Plausible BAC Matches:   P263B22,   P184H18,   P176A14

 Overgo Sequences

A sequence
TGGTGCCCTACCTTTTATGGGTGT
B sequence
GCTAAGGATTTCAACGACACCCAT
AB sequence
TGGTGCCCTACCTTTTATGGGTGTCGTTGA
Marker sequence
AGTCGACCTGCAGATTAGTTGCTTTTAATATGCATCTTCTCCTATGTTTT
GTTTCATCATGAATTATATTTGGAGAATTAAGTCTAATTATGTAGAAATG
ATGAATTGGGATGACGGTGCAGGATTGTTACCCCGATGGCTTTCCATTGG
CCATAGAGTTGTATATCATTCTTGTCTGGTATTGGCGAAAACGTAGTTAC
ATTCTTTCTTTCGGGATTAATGAAGTTGGTGGTTACTTTTGGTAAATAAA
CCAATTTCATAACCAATTAAACTAAAATTTTCATTGCTAATAAGTTGGTG
CCCTACCTTTTATGGGTGTCGTTGAAATCCTTAGCCTCTATATTTATTAG
ATAACTCTTTATTTTGTTGATAAAACCGATAAGATTTTATGGATATG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG31  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D194 marker 194
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)