SGN Marker solcap_snp_sl_15470

SGN-M19400

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71059)
Chromosome
8
Position
70.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67418)
Chromosome
8
Position
68.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55731)
Chromosome
8
Position
61.40 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCTTTACTACTTGTGCTATGATGAGACTGGATAGACGAGCAATAGCAGT
  
3' flanking region
AACATTTTCAGAACATCGAACAGTTCTAGGAATCGGCTTCAGAACAACTA
SNP nucleotide
AC
SNPdb format
CCCTTTACTACTTGTGCTATGATGAGACTGGATAGACGAGCAATAGCAGT[A/C]
AACATTTTCAGAACATCGAACAGTTCTAGGAATCGGCTTCAGAACAACTA
  
Genomic location of solcap_snp_sl_15470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19400 marker 19400
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)