Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T1349

SGN-M1941
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TPTAO48TH
Arabidopsis best BAC match: AB012247.1
Arabidopsis position: 3.0350000
Arabidopsis identities: 0.895
Best GenBank protein hit: BAB02683.1
Evalue: 3.6e-56
Identities: 0.584
Description: long-chain-fatty-acid-CoA ligase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39587)
Chromosome
12
Position
58.10 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1349 was used as an overgo probe on plate 14 [well F6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGGAGCAAGAGTAGGGATTGTGG
B sequence
TCAGCAGAAGGTTTGGCCACAATC
AB sequence
AAGGAGCAAGAGTAGGGATTGTGGCCAAAC
Marker sequence
GCTCAACTTCGCCTCTTATCCTCCGCTACAAGTAGTTTAAGCTATATGGA
GCTGGTCAAGGAAGTTGCCAGCAAGGGACCTGAATCGCAGAAGAATATTG
CGATAAGAGCTGATGAAAAGAGCTACAGTTACCTGCAGTTGATATCATCT
GCTAGGAGAATTTCAAATTTGTTAAGCAAGCTAGATCTTAAAACCGACAA
AGGCATCAAAGAAAATGAACATCACAAAGGAGCAAGAGTAGGGATTGTGG
CCAAACCTTCTGCTGAGTTCGTTGCTGGAATACTAGGGACCTGGCTTAGT
GGAGGTTGTGCAGTTCCTCTTGCTCTGAGCTATCCTGAGAGTGAACTGCT
ACATGTGATGAATGACTCGGACATCTCCATAATTTTGAGTACTGAAGACC
ACCAAGAACTTATGAATGCAATTGCAGCAAAAACTGGTGCTCAGTTGTCT
CTCATTCCTTCAATTCCCGATGTGCATTCATCAACAAAACATGACCAATC
AAAAGACATGGTTTCTGACGGTCAACAAGATCTGCTAGAGATCAATTCCT
ATGGCGAGAACCCTGCTTTTATCTTGTACACCAGCGGCACAACAGGGAAA
CCAAAAGGAGTTGTGCACACACACAATGGAGTCTTAGCACAGGTCCAAAT
GTTAACTAATGCATGGGAATACAC
Genomic location of T1349  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1941 marker 1941
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)