Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_15689

SGN-M19417

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67427)
Chromosome
2
Position
21.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55748)
Chromosome
2
Position
31.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTCAGTTGATGAACCTGTGAGGAATCTAGAGTGGGAAGTTCTTTTGGCC
  
3' flanking region
TTAATAATATCGAAAGAAGCCTCGAACTTGATGGAAATGATGATGGGATT
SNP nucleotide
AG
SNPdb format
ATTCAGTTGATGAACCTGTGAGGAATCTAGAGTGGGAAGTTCTTTTGGCC[A/G]
TTAATAATATCGAAAGAAGCCTCGAACTTGATGGAAATGATGATGGGATT
  
Genomic location of solcap_snp_sl_15689  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19417 marker 19417
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)