SGN Marker solcap_snp_sl_15696

SGN-M19421

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67429)
Chromosome
2
Position
21.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63863)
Chromosome
2
Position
25.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55752)
Chromosome
2
Position
31.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCTCCGTACCAACAGGGACTAATGCTGGAGGAGTTCCTGCTGTTGACTC
  
3' flanking region
CCACAAGTTGGAGCTCAGTCTGTGCCTCCGTCAAACAGGCCTCCTTATGA
SNP nucleotide
AT
SNPdb format
GGCTCCGTACCAACAGGGACTAATGCTGGAGGAGTTCCTGCTGTTGACTC[A/T]
CCACAAGTTGGAGCTCAGTCTGTGCCTCCGTCAAACAGGCCTCCTTATGA
  
Genomic location of solcap_snp_sl_15696  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19421 marker 19421
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)