SGN Marker T1352

SGN-M1944
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAO59TH
Arabidopsis best BAC match: AC007060.2
Arabidopsis position: 1.0642000
Arabidopsis identities: 0.850
Best GenBank protein hit: AAD25749.1
Evalue: 5.7e-80
Identities: 0.828
Description: Strong similarity to F19I3.8 gi|3033381 putative UDP-galactose-4-epimerase from Arabidopsis thaliana [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39588)
Chromosome
8
Position
25.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1352 was used as an overgo probe on plate 13 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGTAGCATATGTCGGAGAGAGCA
B sequence
TTTAGAGGATCGAGGGTGCTCTCT
AB sequence
CTGTAGCATATGTCGGAGAGAGCACCCTCG
Marker sequence
GCTGAACCTTCTCCCTCTTTACTGATAACAGTTCCACATACAAGGAAGGG
GCTTACTTGATCAGTAGTTTCAAGTAATAAGATAATCTAATTTGATTGGT
TGCCTATTTGGCATTGGAGAGATTATGCTAGGCTTGGGCAGGGGAAGAGC
TCAAACAAGGTCTAGCAGATCTATGTCTCTAGGAGGCATTGATTATGCAG
ACCCAAAGAAGAAGAGCAATTTTGTGGGTAAAATTCTTATGGCTGCTGTG
CTAACAGCGCTATGCATTCTTATGCTCAAGCAGTCTCCAACTTTTAATAC
CCCAAGTGCATTCTCTCGCCATCAACCAGGTGTTGTTCATGTCTTAGTCA
CCGGAGGTGCTGGCTACATTGGTTCCCATGCAGCATTACGACTTTTAAAA
GAAAATTACCGGGTGACGATAGTGGACAACCTTTCACGAGGAAATATGGG
AGCTGTGAGGATTCTGCAAGAATTATTTCCTGAACCAGGGAGGCTTCAGT
TTATATATGCTGACTTGGGGGATGCAAAAGTGGTCCACCAGATATTNTCC
CAGAATGCTTTTGATGCTGTGATGCATTTTGCAGCTGTAGCATATGTCGG
AGAGAGCACCCTCGATCCTCTAAAGTACTATCACAACATTACTTCAAAT
Genomic location of T1352  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1944 marker 1944
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)