SGN Marker solcap_snp_sl_15790

SGN-M19443

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71077)
Chromosome
7
Position
23.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67438)
Chromosome
7
Position
3.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55774)
Chromosome
7
Position
2.88 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTACTTCCATCATACCCATAGTGCTGAATATGACGATTCTCCTTCTTGG
  
3' flanking region
AATATATGTTGGGTTGAAAGATCACCTCTAGCCCAAAGTTTACCCGAAGT
SNP nucleotide
TG
SNPdb format
ACTACTTCCATCATACCCATAGTGCTGAATATGACGATTCTCCTTCTTGG[T/G]
AATATATGTTGGGTTGAAAGATCACCTCTAGCCCAAAGTTTACCCGAAGT
  
Genomic location of solcap_snp_sl_15790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19443 marker 19443
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)