SGN Marker solcap_snp_sl_15875

SGN-M19447

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71080)
Chromosome
5
Position
3.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55778)
Chromosome
5
Position
0.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTTGTTCAGTAGCATTTGGTGCTGATCAATTAGAGAACAAACGAAATCC
  
3' flanking region
GATAATGAGAGAGTTATGGATACCTATTTCAACTGGTTTTATGCTAGTGT
SNP nucleotide
AG
SNPdb format
CCTTGTTCAGTAGCATTTGGTGCTGATCAATTAGAGAACAAACGAAATCC[A/G]
GATAATGAGAGAGTTATGGATACCTATTTCAACTGGTTTTATGCTAGTGT
  
Genomic location of solcap_snp_sl_15875  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19447 marker 19447
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)