SGN Marker solcap_snp_sl_15884

SGN-M19455

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67442)
Chromosome
5
Position
2.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55786)
Chromosome
5
Position
0.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTATATTTAGATAGCAAAGGGACCAAAAGACGATCATAGAAAATAATCCA
  
3' flanking region
ATTGTTAAAGCGATAATCAGGAACACACTGAATGATGCTGCTGGTACTTC
SNP nucleotide
CG
SNPdb format
GTATATTTAGATAGCAAAGGGACCAAAAGACGATCATAGAAAATAATCCA[C/G]
ATTGTTAAAGCGATAATCAGGAACACACTGAATGATGCTGCTGGTACTTC
  
Genomic location of solcap_snp_sl_15884  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19455 marker 19455
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)