SGN Marker solcap_snp_sl_15889

SGN-M19458

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67445)
Chromosome
5
Position
2.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63875)
Chromosome
5
Position
4.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55789)
Chromosome
5
Position
0.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACTTGCTATTAGGATTGTTCCAAGCAGGTGCAGCTGCTTTTAGAAAAAG
  
3' flanking region
AAAACCCCTCTTTCATTGACTGGTTGTGATGACTACTATCATTCGCCATA
SNP nucleotide
AG
SNPdb format
AACTTGCTATTAGGATTGTTCCAAGCAGGTGCAGCTGCTTTTAGAAAAAG[A/G]
AAAACCCCTCTTTCATTGACTGGTTGTGATGACTACTATCATTCGCCATA
  
Genomic location of solcap_snp_sl_15889  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19458 marker 19458
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)