SGN Marker T1355

SGN-M1947
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAO86TH
Arabidopsis best BAC match: AC025295.5
Arabidopsis position: 1.0640900
Arabidopsis identities: 0.802
Best GenBank protein hit: AAD15333.1
Evalue: 1.6e-38
Identities: 0.388
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39589)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1355 was used as an overgo probe on plate 7 [well E10]

Plausible BAC Matches:   P097P15,   P079C10,   P001C13,   P179B17,   P321H10,   P134B02,   P213E05,   P005H23,   P307B24,   P140K02

 Overgo Sequences

A sequence
CTGGGTGGAACTCTATTCACTTCC
B sequence
GCTCGATGCTCTTGAAGGAAGTGA
AB sequence
CTGGGTGGAACTCTATTCACTTCCTTCAAG
Marker sequence
GGTCAAGACAGTGCTAGAAGCGTATTTACCTCAACTTGCACTTATCTTAT
TTTTGGCTTTGTTGCCAAAGTTTCTTCTGTTTCTATCCAAAGCAGAGGGC
ATCCCATCAGAAAGCCACGTGACAAGAGCTGCTTCAGGGAAATATTTTTA
TTTCACCGTGTTGAATGTATTTATTGGTGTTACTCTGGGTGGAACTCTAT
TCACTTCCTTCAAGAGCATCGAGCATGATCCCAACTCTATTTTTCGTGTG
TTGGCAAAAAGCCTTCCACAGAATGCAACTTTCTTCTTGACTTTTGTGGC
TTTGAAATTCTTTGTTGGCTACGGGCTGGAACTATCTAGAATAGTTCCTC
TAATCATATTCCATCTCAAGAAGAAGTATTTGTGCAAAACTGAAGCTGAG
ATAAAGGAGGCTTGGGCTCCTGGTGATCTAGGCTATGCAACTCGATTTCC
CAATGATATGCTGATTATGACGATTGTCCTATGCTATTCCGTCATAGCTC
CAATAATTATTCCGTTTGGTGTGGTATACTTTGGTCTAGGGTGGCTTCTT
CTCCGGAATCAGGCACTCAAAGTGTATGTTCCCTCATTCGAGAGCTACGG
AAAGATGTGGCCCCATATTTACACGCGCATGATAGCTACCTTGATTTTGT
ATCAAGTTACCATGTTAGGTTACTTTGGTGTT
Genomic location of T1355  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1947 marker 1947
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)